Rel/NF-kappaB target genes


This page contains a compilation of Rel/NF-kappaB target genes that is derived from the survey paper Activators and target genes of Rel/NF-kappaB transcription factors (Pahl, Oncogene 1999), the Rel/NF-kappaB transcription factors website of TD Gilmore, and additional search with PubMed. We distinguish four groups of genes: Human genes with checked binding sites (there is a strong experimental evidence of Rel/NF-kappaB direct control, such as chromatin immunoprecipitation or promoter transactivation), putative Human genes, checked genes in orthologous species (mouse, rat , rabbit), and putative genes in orthologous species.

For each entry, the following information is available

[File containing all Human identifiers]

[File containing all Mouse identifiers]


PubMed Name Description OMIM Species RefSeq (Human) Promoter Ortholog (Mouse) Site location Site sequence
Human genes with checked binding sites
11922943 IGHG4 immunoglobulin heavy constant gamma 4 (G4m marker) 147130 human K01316 K01316 -65/-56
10760789 IGHG3 immunoglobulin heavy constant gamma 3 (G3m marker) 147120 human M12958 M12958
8036173 APOC3 apolipoprotein C-III 107720 human NM_000040 NM_000040 NM_023114 -159 GGGATTTCCC
10022897 TNFRSF6 tumor necrosis factor receptor superfamily, member 6 (cCD95 Fas) 134637 human NM_000043 NM_000043 NM_007987 -295/-286 GGGCGTTCCC
12374807 CD3G T-cell receptor/CD3gamma, CD3G antigen, gamma polypeptide (TiT3 complex) 186740 human NM_000073 NM_000073 NM_009850 -124/-120, +450/+454 GGAAA, GGAAA
11751888 TNFSF5 t CD40L tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) 300386 human NM_000074 NM_000074 NM_011616 -1191/-1181 and in the 3' flanking region 946/-956 GGGATTTCCA, GGAATTTTCC
9845534 CD105 endoglin (Osler-Rendu-Weber syndrome 1) (ENG) 131195 human NM_000118 NM_000118 NM_007932 -218/-210 GGGGCTCCC
8970974 ICAM1 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor 147840 human NM_000201 NM_000201 NM_010493 -185/-177 GGAAATTCC
12208876 TPMT thiopurine S-methyltransferase 187680 human NM_000367 NM_000367 NM_016785 -692/-683 GGGAATTCCC
1508203 IL2RA i IL-2 receptor alpha chain interleukin 2 receptor, alpha chain 147730 human NM_000417 NM_000417 NM_008367 -267/-258 GGGAATCTCC
1710341 SELE selectin E (endothelial adhesion molecule 1) ELAM1 131210 human NM_000450 NM_000450 NM_011345 -135,-164, -145 GGGGATTTCC, GATATTCC, GGATG
8051093 TP53 tumor protein p53 (Li-Fraumeni syndrome) 191170 human NM_000546 NM_000546 NM_011640 +49/+68 GGGGTTTTCC
11035101 CRP C-reactive protein, pentraxin-related 123260 human NM_000567 NM_000567 NM_007768 -50/-41 AAACTCCCTT
8605359 IL1A interleukin 1, alpha 147760 human NM_000575 NM_000575 NM_010554 -1065/-1056, +646/+655 GGGGCATGCC, GGGGCTCCCC
8413223 IL1B interleukin 1, beta 147720 human NM_000576 NM_000576 NM_008361 -300/-289 GGGAAAATCC
7930581 IL1RN interleukin 1 receptor antagonist 147679 human NM_000577 NM_000577 NM_031167 -93/-84 GGGTATTTCC
9840284 CCR5 chemokine (C-C motif) receptor 5 601373 human NM_000579 NM_000579 NM_009917 -682 GTGAAAATCCC
8207232 IL8 interleukin 8 146930 human NM_000584 NM_000584 -82/-72 GTGGAATTTCC
2497518 IL2 interleukin 2 147680 human NM_000586 NM_000586 NM_008366 -206/-195 AGGGATTTCACC
8663174 IL9 interleukin 9 146931 human NM_000590 NM_000590 NM_008373 -59/-50 GGGTTTTTCC
7699330 TAP1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) 170260 human NM_000593 NM_000593 NM_013683 -38/-47 from the third major start site upstream from the ATG GGGACTTTCC
2104921+1715367+2263628 TNF tumor necrosis factor (TNF superfamily, member 2) TNF alpha 191160 human NM_000594 NM_000594 NM_013693 -579/-586,-202/-211,-99/-89 GGGACAGCCC, GGGGTATCC, GGGTTTCTCC
9541585 LTA lymphotoxin alpha (TNF superfamily, member 1) 153440 human NM_000595 NM_000595 NM_010735 -99/-89 GGGGGCTTCCC
8972179 IL6 interleukin 6 (interferon, beta 2) 147620 human NM_000600 NM_000600 -73/-63 GGGATTTTCCC
12208876 CD44 CD44 antigen (homing function and Indian blood group system) 107269 human NM_000610 NM_000610 +87/+97 GGGATCCTCC
8607810 NOS2A nitric oxide synthase 2A (inducible, hepatocytes) 163730 human NM_000625 NM_000625 NM_010927 -115/-106 GGGACACTCC
10492402 SOD2 MnSOD, superoxide dismutase 2, mitochondrial 147460 human NM_000636 NM_000636 NM_013671 -350/-341, -1420/-1411,+2759/+2768 GGGTCTTCCC, GGGGCTTTCC, GGGAATACCC
10744679 TNFSF6 tumor necrosis factor (fas ligand) superfamily, member 6 134638 human NM_000639 NM_000639 NM_010177 -1088
9191851 IL11 interleukin 11 147681 human NM_000641 NM_000641 NM_008350 -690 TCGGGGTCTCCCTGGGTCTCCCAA
9446586 BDKRB1 bradykinin receptor B 600337 human NM_000710 NM_000710 NM_007539 -64/-55 GGCAATCCC
1912581 CSF1 colony stimulating factor 1 (macrophage) (M-CSF) 120420 human NM_172212 NM_172212 NM_007778 -377/-368 GGGACTTTCC
2406568+11418664 CSF2 colony stimulating factor 2 (granulocyte-macrophage) (IGM-CSF) 138960 human NM_000758 NM_000758 NM_009969 -86/-77, -101/-92 AGGTAGTTCC, GAGATTCCAC
7513199 CSF3 colony stimulating factor 3 (granulocyte) (G-CSF) 138970 human NM_000759 NM_000759 NM_009971 -179/-188 GAGATTCCAC
8546677 GSTP1 glutathione S-transferase pi 134660 human NM_000852 NM_000852 NM_013541 -96/-86 GGGACCCTCC
9058597 NQO1 NAD(P)H dehydrogenase, quinone 1 125860 human NM_000903 NM_000903 NM_008706 -830/-820 GGGGCTTCAC
14500744 OPRM1 opioid receptor, mu 1 600018 human NM_000914 NM_000914 NM_011013 -1968, -352, -2 GGGACTTTCA, GGGGTTTTAG, GGGGCTATAC
10403752 PTAFR platelet-activating factor receptor 173393 human NM_000952 NM_000952 -1099/-610
9514889+12471036 PTGS2 prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (COX-2) 600262 human NM_000963 NM_000963 NM_011198 -438/-447, -231/-222 GGGGATTCCC, GGGACTACCC
12023897 SCNN1A Amiloride-sensitive sodium channel, nonvoltage-gated 1 alpha 600228 human NM_001038 NM_001038 NM_011324 -506 CCTTGGAGGG
1379595 VCAM1 vascular cell adhesion molecule 1 192225 human NM_001078 NM_001078 NM_011693 -77/-68, -63/-54 GGGTTTCCCC, AGGGATTTCCC
10829018, 9195959 AGER advanced glycosylation end product-specific receptor 600214 human NM_172197 NM_172197 NM_007425 -671/-663 ,-1518/-1510 GAGAAACCCC, GGGAACCCCT
7729529 ALOX12B arachidonate 12-lipoxygenase, 12R type 603741 human NM_000697 NM_000697 NM_009659 -505 GGGACATCCC
12226754 BCL2L1 BCL2-like 1 600039 human NM_001191 NM_001191 NM_009743 -341/-350, -357/-366, -59/-84 GTGACTTTCC, GGGGACTGCC, GGGACTGCCC
11313274 TNFRSF5 tumor necrosis factor receptor superfamily, member 5 (CD40) 109535 human NM_001250 NM_001250 NM_011611 -576/-566, -468/-458, -174/-164 GGGAATTTCC, GGGAACTTCC, GGGAAACTCC
12706838 TNFRSF9 tumor necrosis factor receptor superfamily, member 9 (CD137) 602250 human NM_001561 NM_001561 NM_011612 -89/-77 GTGGGAATTTCCCA
11877397 IRF7 interferon regulatory factor 7 605047 human NM_004030 NM_004030 NM_016850 -51/-60 GGAAACTCC
9786883 BLR1 Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5 CXCR5) 601613 human NM_001716 NM_001716 NM_007551 +44/+54 +2 other sites located between -612/-1 GGGATTTTCCC, GGAGTTTCCC, GGGGTTTCCCA
7815555 CD48 CD48 antigen (B-cell membrane protein) 109530 human NM_001778 NM_001778 NM_007649 -1149/-1133 GGAAGGGGCTTTCCCCA
7665567 CD69 CD69 antigen (p60, early T-cell activation antigen) 107273 human NM_001781 NM_001781 -373,-223,-160 GGGAAAACCC
12208876 CCR7 chemokine (C-C motif) receptor 7 600242 human NM_001838 NM_001838 NM_007719 -350/-341, -223/-214 GGGACACTTC, GGGGCTTTTT
12444129 CR2 complement receptor 2 : complement component (3d/Epstein Barr virus) receptor 2 120650 human NM_001877 NM_001877 NM_007758 -531/-509 AGTATATGGGAATTCTCTGCAGT
1744583 F3 coagulation factor III (thromboplastin, tissue factor) 134390 human NM_001993 NM_001993 NM_010171 -188 GGGAGTTTCC
8016102 HMOX1 heme oxygenase (decycling) 1 141250 human NM_002133 NM_002133 NM_010442 -173/-152 GACTTTGTTTCCCAAGGGTCA
9154819 TNC tenascin C (hexabrachion) 187380 human NM_002160 NM_002160 NM_011607 -219/-210 GGGAATTCCT
2542571 IFNB1 interferon, beta 1, fibroblast 147640 human NM_002176 NM_002176 NM_010510 -64/-55 GGGAAATTCC
12208876 IL13 interleukin 13 147683 human NM_002188 NM_002188 NM_008355 -1291/-1282, -1082/-1073 GGGATGCCTC, GGGGGTTTCT
11160322 IL15RA interleukin 15 receptor, alpha 601070 human NM_172200 NM_172200 NM_008358 -989/-979 GGGATTTCCC
7507207 IRF1 interferon regulatory factor 1 147575 human NM_002198 NM_002198 NM_008390 -47/-38 GGGGAATCCC
7507207 IRF2 interferon regulatory factor 2 147576 human NM_002199 NM_002199 NM_008391 -33/-24 GGGGATTTCC
8786306 LTB lymphotoxin beta (TNF superfamily, member 3) 600978 human NM_009588 NM_009588 NM_008518 -110/+1 GGAAAGTCCC
12218129 IRF4 interferon regulatory factor 4 601900 human NM_002460 NM_002460 NM_013674 -445, -517 GCGAAGTCCCC, GGGTGCTCCC
11306700 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 190080 human NM_002467 NM_002467 NM_010849 -1329, 269 AAGGGTCT, GGGGACAC
7541912 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) 164012 human NM_002502 NM_002502 NM_019408 -377/-387, -95/-105, -68/-78, +701/+691, +955/+945, +1108/+1098 from the major start site GGGGATCCCCC, GGGAATTCCC, GGGGCTTTCCG, GGGCCTCCC, GGGGCTTCCCG, GGGACTTTCC
7635955 PDGFB platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) 190040 human NM_002608 NM_002608 NM_011057 -125/-115 GAGACC
10824110 PLAU urokinase-type plasminogen activator 173391 human NM_002658 NM_002658 NM_008873 -1865 et-1835, et-47 GGGAATTTCC, GGGAGTTTC, GGGAGGAGTC
7699330 LMP2 proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2) (PSMB9) 177045 human NM_002800 NM_002800 NM_013585 -407/-398 from the third major start site upstream from the ATG GGGACTTTCC
9079634 PTX3 pentaxin-related gene, rapidly induced by IL-1 beta 602492 human NM_002852 NM_002852 -87/-97, -1126/-1136 GGGGAACTCCC, CGGGATTTTCC
8051410, 9174597 CCL2 chemokine (C-C motif) ligand 2 (MCP1/JE) 158105 human NM_002982 NM_002982 NM_011333 -2600, -78 GGGAATTTCC, GGAAGATCCC
9120310 CCL5 chemokine (C-C motif) ligand 5 (RANTES) 187011 human NM_002985 NM_002985 -40,-54,-221,-590 GGGGATGCCC, GGAAACTCCC, AGAAATTTTTCC, AGAAATTCCC
11076795 CCL11 chemokine (C-C motif) ligand 11 601156 human NM_002986 NM_002986 NM_011330 -68/-60 GGAATCTCCC
11559712 CXCL5 Neutrophil activating peptide-78, chemokine (C-X-C motif) ligand 5 600324 human NM_002994 NM_002994 NM_009141 -82/-91 CAGGGAATTTCCCCA
7559449 SELP selectin P (granule membrane protein 140kDa, antigen CD62) 173610 human NM_003005 NM_003005 NM_011347 -123 GGGGGTGACCCC
12208876 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 (GLUT5) 138230 human NM_003039 NM_003039 NM_019741 -194/-185, -142/-133 GGGAAATACC, GGGGGCACCC
12208876+12208876 STAT5A signal transducer and activator of transcription 5A 601511 human NM_003152 NM_003152 NM_011488 -127/-118, -40/-31 GGGGAGGCC, GGGGCCTCTT
8420985 VIM vimentin 193060 human NM_003380 NM_003380 NM_011701 -217/-226 GGGGCTTTCC
12360408 IER3 immediate early response 3 (IEX-1L) 602996 human NM_003897 NM_003897 NM_133662 -102/-92 CGGAATTTCC
1740105 NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) 164011 human NM_003998 NM_003998 NM_008689 -304 GGGGGCTTCCC
12480693 BM2 beta-2-microglobulin 109700 human NM_004048 NM_004048 -96 GGGAAAGTCCC
10049353 BCL2A1 BCL2-related protein A1 601056 human NM_004049 NM_004049 NM_009742 -833/-823 GGGGATTTACC
12414801 CCL15 chemokine (C-C motif) ligand 15 (MIP-3alpha) 601393 human NM_004591 NM_004591 -92 GGGAAAACCC
11275263+12182451 CD83 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) 604534 human NM_004233 NM_004233 NM_009856 0/-261
8164652 CD74 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 142790 human NM_004355 NM_004355 NM_010545 -109/-118, -163/-172 GGGGTATTTCC, GGGGAGCCCC
12746898 ELF3 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) (ESE-1) 602191 human NM_004433 NM_004433 NM_007921 -88/-79 GGAAATCCCC
9486175 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 190196 human NM_004613 NM_004613 NM_009373 -1338
12958190 DEFB4 defensin, beta 4 602056 human NM_004942 NM_004942 NM_019728 -175/-167, -165/-157 relative to the TATA box GGGATTTTC, GGGGTTTCC
8631874 MMP9 matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) 120361 human NM_004994 NM_004994 NM_013599 -600/-610 GGGGGTTGCCCC
11387332 BCL3 B-cell CLL/lymphoma 3 109560 human NM_005178 NM_005178 NM_033601 -937, -171 AGGATTTTCCGA, TCCTTTGGGA
8642282+890682 CD80 CD80 antigen (CD28 antigen ligand 1, B7-1 antigen) 112203 human NM_005191 NM_005191 NM_009855 -2977/-2967 GGGGTTTTCCC
12471041 VEGF C vascular endothelial growth factor C 601528 human NM_005429 NM_005429 NM_009506 +401/+410 GGGGGTCGCC
14550290 PLCD1 phospholipase C, delta 1 602142 human NM_006225 NM_006225 NM_019676 -1306/-1288 GGGACTTTCC
1381359 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 (A20) 191163 human NM_006290 NM_006290 NM_009397 -239, -251 GGAAATCCCC, GGAAAGTCCC
11753650 RELB v-rel reticuloendotheliosis viral oncogene homolog B, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 (avian) 604758 human NM_006509 NM_006509 NM_009046 from ATG -247/-238, -175/-166 (-114=1rst main TSS, -126= 2nd main TSS) GGGGTTTTCC, GGGGAATTCC
11978801+12208876 TFPI2 tissue factor pathway inhibitor 2 600033 human NM_006528 NM_006528 NM_009364 -234/-225 GGGGAATTCC
12835724+10733571 BCL2 B-cell CLL/lymphoma 2 151430 human NM_000657 NM_000657 NM_009741 -180 (ou -28) GGGAAACACC
12859951 S100A6 S100 calcium binding protein A6 (calcyclin) 114110 human NM_014624 NM_014624 NM_011313 -460/-451 GGGAGTAGCC
12594338 TACR1 tachykinin receptor 1, neurokinin 1 receptor (NK-1R) 162323 human NM_015727 NM_015727 NM_009313 -532/-543 GGGTGTTTCC
12208876 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha 164008 human NM_020529 NM_020529 NM_010907 -319/-310, -225/-216, -63/-53 GGAAACCC, GGGAGGACTTTC, GGAAATTCCCC
12957386 CD209 antigen (DC-SIGN) 604672 human NM_021155 NM_021155 NM_133238 +426/+433 of the fourth TSS 5' from the ATG AGGGTGGG
12194982 CARD15 caspase recruitment domain family, member 15 (Nod2) 605956 human NM_022162 NM_022162 NM_145857 -25 GGGAATTTCC
10082535+10409765 CCND1 cyclin D1 (PRAD1: parathyroid adenomatosis 1) 168461 human NM_053056 NM_053056 NM_007631 -806, 13 GGGGACCCC, GGGGAGTTTT
11909978 KLK3 kallikrein 3, (prostate specific antigen) 176820 human NM_145864 NM_145864 4 sites located in an enhancer at -4366/-3824 TGCCCCCCCC, GGGGTTTGTG, GGGACAACTT, GGTGGTGCTG
9482906 IL15 interleukin 15 600554 human NM_172174 NM_172174 NM_008357 -212 GGGGCTCCT
11884470 NR4A2 nuclear receptor subfamily 4, group A, member 2 (NURR1) 601828 human NM_173173 NM_173173 NM_013613 -585/-576 GGGAAATCCC
10867022 HC3 proteasome subunit alpha-type 2 (PSMA2) human NM_002787 NM_002787 NM_008944 -304, -324 GGAAGCTTCC, CCTTTCGGG
Checked binding sites - other species
serum amyloid A3 mouse
Complement B mouse
H+-K+ATPase alpha2 mouse
PKCdelta mouse
Pregnancy-specific glycoprotein rnCGM3 rat
Serpin 2A mouse
AR androgen receptor (dihydrotestosterone receptor; Testicular feminization; Spinal and bulbar muscular atrophy; Kennedy disease) 313700 rat NM_000044 NM_000044 NM_013476
SERPINA1 alpha antitrypsin, serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 (SERPINA1) 107400 rabbit NM_000295 NM_000295 NM_009245
AMH anti-Mullerian hormone 600957 mouse NM_000479 NM_000479 NM_007445
ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide 103700 rat NM_000667 NM_000667 NM_007409
NPY1R neuropeptide Y receptor Y1 162641 mouse NM_000909 NM_000909 NM_010934
ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 171050 rat or mouse NM_000927 NM_000927 NM_011076
PTGDS Lipocalin-type prostaglandin D synthase : prostaglandin D2 synthase 21kDa (brain) 176803 rat NM_000954 NM_000954 NM_008963
BMP2 bone morphogenetic protein 2 112261 mouse NM_001200 NM_001200 NM_007553
CASP4 caspase 4, apoptosis-related cysteine protease 602664 mouse NM_001225 NM_001225 NM_007609
TBR T cell receptor beta locus 186930 mouse NM_001333 NM_001333 NM_009984
CXCL10 chemokine (C-X-C motif) ligand 10 (IP-10) 147310 mouse NM_001565 NM_001565 NM_021274
FN1 fibronectin 1 135600 rat NM_002026 NM_002026
FTH1 ferritin H chain, heavy polypeptide 1 134770 rat NM_002032 NM_002032 NM_010239
CXCL2 chemokine (C-X-C motif) ligand 2 (MIP2) 139110 mouse NM_002089 NM_002089 NM_009140
CXCL9 chemokine (C-X-C motif) ligand 9 601704 mouse NM_002416 NM_002416 NM_008599
CCL4 chemokine (C-C motif) ligand 4 (MIP1beta) 182284 mouse NM_002984 NM_002984 NM_013652
SIAT8A sialyltransferase 8A (alpha-N-acetylneuraminate: alpha-2,8-sialyltransferase, GD3 synthase) 601123 mouse NM_003034 NM_003034 NM_011374
TERT telomerase reverse transcriptase 187270 mouse NM_003219 NM_003219 NM_009354
ARFRP1 ADP-ribosylation factor related protein 1 604699 mouse NM_003224 NM_003224 NM_029702
MYB v-myb myeloblastosis viral oncogene homolog (avian) 189990 mouse NM_005375 NM_005375 NM_010848
PENK proenkephalin 131330 rat NM_006211 NM_006211
PLA2G4 phospholipase A2, group IVA (cytosolic, calcium-dependent) 600522 rat NM_024420 NM_024420 NM_008869
Mail 608004 mouse NM_031419 NM_031419 NM_030612
MADCAM1 mucosal vascular addressin cell adhesion molecule 1 102670 mouse NM_130760 NM_130760 NM_013591
TAPBP TAP binding protein (tapasin) 601962 mouse NM_172209 NM_172209 NM_009318
Putative Human target genes
12505312 CYP2C11 human
NK4 human
2106065 AGT angiotensinogen (serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 8) 106150 human NM_000029 NM_000029 NM_007428
12513753 WT1 Wilms tumor 1 607102 human NM_000378 NM_000378 NM_144783
10098886 G6PD glucose-6-phosphate dehydrogenase 305900 human NM_000402 NM_000402 NM_008062
12471121 IL10 interleukin 10 124092 human NM_000572 NM_000572 NM_010548
ORM1 orosomucoid 1, alpha-1 acid glycoprotein 138600 human NM_000607 NM_000607 NM_008768
9547356 ADORA1 adenosine A1 receptor 102775 human NM_000674 NM_000674
2550553 C4BPA complement component 4 binding protein, alpha 120830 human NM_000715 NM_000715 NM_007576
12482504 EPO erythropoietin 133170 human NM_000799 NM_000799 NM_007942
12411322 BIRC2 baculoviral IAP repeat-containing 2 601712 human NM_001166 NM_001166 NM_007465
9990294 HAS1 hyaluronan synthase 1 601463 human NM_001523 NM_001523 NM_008215
12070780 FCER2 Fc epsilon receptor II(CD23), Fc fragment of IgE, low affinity II, receptor for (CD23A) 151445 human NM_002002 NM_002002 NM_013517
12388107 FN1 fibronectin 1 135600 human NM_002026 NM_002026
10874048 JUNB jun B proto-oncogene 165161 human NM_002229 NM_002229 NM_008416
8623933 LGALS3 lectin, galactoside-binding, soluble, 3 (galectin 3) 153619 human NM_002306 NM_002306 NM_010705
12483727 MMP8 matrix metalloproteinase 8 (neutrophil collagenase) 120355 human NM_002424 NM_002424 NM_008611
12237307+12077118 MUC2 mucin 2, intestinal/tracheal 158370 human NM_002457 NM_002457
11777968 PIM1 pim-1 oncogene 164960 human NM_002648 NM_002648 NM_008842
2284104 REL v-rel reticuloendotheliosis viral oncogene homolog (avian) (c-rel) 164910 human NM_002908 NM_002908 NM_009044
11342414 CCL3 chemokine (C-C motif) ligand 3 (MIP1alpha) 182283 human NM_002983 NM_002983 NM_011337
12378635 CCL4 chemokine (C-C motif) ligand 4 (aka LAG-1) 182284 human NM_002984 NM_002984 NM_013652
11875461+11359904 CFLAR caspase-8-c-FLIP (flice inhibitory protein) and FADD-like apoptosis regulator 603599 human NM_003879 NM_003879 NM_009805
11875461 BAX BCL2-associated X protein 600040 human NM_004324 NM_004324 NM_007527
12133954 PRF1 perforin 1 (pore forming protein) 170280 human NM_005041 NM_005041 NM_011073
11942414 HBE1 hemoglobin, epsilon 1 142100 human NM_005330 NM_005330
9733516 TRAF1 TNF receptor-associated factor 1 601711 human NM_005658 NM_005658 NM_009421
12221085 CCL7 chemokine (C-C motif) ligand 7 (Mcp-3) human NM_006273 NM_006273 NM_013654
11875461 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 (DR6) 605732 human NM_014452 NM_014452 NM_178589
11713530 GADD45B growth arrest and DNA-damage-inducible, beta 604948 human NM_015675 NM_015675 NM_008655
9733516 TRAF2 TNF receptor-associated factor 2 601895 human NM_021138 NM_021138 NM_009422
7968369 PDYN prodynorphin (preproenkephalin) 131340 human NM_024411 NM_024411 NM_018863
7999086 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium-dependent) 600522 human NM_024420 NM_024420 NM_008869
Putative target genes - other species
C4B complement component 4B 120820 rat NM_000592 NM_000592 NM_009780
JUNB jun B proto-oncogene 165161 mouse NM_002229 NM_002229 NM_008416
MMP8 matrix metalloproteinase 8 (neutrophil collagenase) 120355 rabbit NM_002424 NM_002424 NM_008611
OLR1 oxidised low density lipoprotein (lectin-like) receptor 1 (lox1) 602601 rat NM_002543 NM_002543 NM_138648
LAMC2 lamin chain beta, laminin, gamma 2 150292 mouse NM_005562 NM_005562 NM_008485
BCL2L10 BCL2-like 10 (apoptosis facilitator) (Nr13) 606910 ? NM_020396 NM_020396 NM_013479
Mail 608004 mouse NM_031419 NM_031419 NM_030612
PKCdelta mouse

Top of the page

Karo Gosselin, Hélène Touzet, Corinne Abbadie, Institut de Biologie de Lille et LIFL, feb 2004