carnac :: RNA structure inference

Submission form

Your data set should include at least two distinct RNA sequences, and sequences should be in FASTA format. A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 characters.

Example of FASTA format:

> Name of the sequence 1
ctgcgagcgcgcgatgatagcgcggcgagcatgtagcatgctagctgtcgcgagcact
cggccgagatcaggcgatgcatgcgcagggagcagcgagcgacgagcacagcatgcta
gctagatgcatgctgtaggcagc
cgccgagagacgatggagctgc
> Name of the sequence 2
gacagatacgataagaggacgggatagaacgtagacatcgccgagagacgatggagctgc
cggccgagatcaggcgatgcatgcgcagggagcaggcgagcatgtagcatgctagctgtc
gcgagcact

Lower-case and upper-case letters are both accepted. The full standard IUPAC nucleic acid code is not supported: only A, C, G, T and U symbols are recognized. Numerical digits 0, ..., 9, - and dot . symbols are accepted. They are simply ignored by Carnac.

Carnac offers several parameters that determine the final predictions The most reasonable choice is to use default values. This choice leads to the most reliable results in average.

Eliminate redundant sequences
By default, CARNAC discards sequences that are too close (more than 98% of identity). You should uncheck the box if you want all your sequences to be folded.

Take GC content into consideration
When this option is selected, Carnac uses variable energy thresholds for stems according to the average GC percent of the involved sequence.

Allow isolated stems
When this option is selected, Carnac permits the creation of stems in one sequence alone, without any counterpart in any other sequence. This option may give better results if there is a large evolutionnary distance between structures, or when the sequences are of different lengths. But it is time and space consuming. So it should be selected with caution.

Ouput files


For each sequence, Carnac computes a putative secondary structure. The result is stored in four formats: CT, JPEG, PS, and as a list of contrained base pairings. JPEG and PS files are both automatically produced from the CT file using NAview. It is also possible to visualize all structures in the same window with the home-made Java applet RNAfamily.

If no structure is detected, then the message No structure found is displayed.

CT - Connectivity Table format
This is a text file which contains the nucleic acid sequence and base pairing information from which a structure plot may be computed.

JPEG - Joint Photographic Experts Group format
This is a graphical format that produces inline images for web-pages and documents.

PS - PostScript format
This is a ready-to-print high quality vector format. It may require additional tools for viewing, such as gsview.

List of constraints - this file describes the structure as a set of initial contraints for external programs, such as Kinefold or Mfold. Each line corresponds to one helix: F i j k forces the formation of base pairs i.j, i+1.j-1, ... , i+k-1.j-k+1.

It is also possible to download an archive storing all result files (ct, ps, jpeg and constraints).

Retrieve result with an ID


Each job is assigned an identifier, that allows to retrieve folding results. Files are stored for 24h after job submission.