miRkwood small RNA-seq

Quick start

This page covers the basics on how to get started with miRkwood small RNA-seq. A comprehensive user guide is to be found here.

The main input of miRkwood is a set of reads (ranging from 15 nt to 35 nt approximately) that have been previously mapped on a reference genome and that are stored in a file in BED format. We advise you to first practice with the sample BED file below.

This file contains Illumina reads for Arabidopsis thaliana from SRA SRR960237 . We have mapped these reads on TAIR 10, and have selected 2 portions of reads, one from chromosome 1 and one from chromosome 4. This gives a total of 319,103 reads.

If you want to know more on how to create this BED file for your data, check out the detailed instruction.

Input form

You can now open the input form on the web server.

Upload your set of reads: choose the downloaded sample BED file on your local disk.

Select a species: choose the Arabidospsis thaliana TAIR 10 assembly.

Parameters: keep all default options.

Finally, click the Run miRkwood button. Results will be displayed in a couple of minutes.

Results page

The top of the page displays the job ID, that can be saved for future usage (with the link retrieve a result with an ID, on the main menu).

The result page has then two main parts. The first one (Options summary) is simply a summary of your job parameters. The other one (Results summary) provides the detailed results.

read graphics

This diagram indicates the proportion of reads found for each category. This is a graphical visualisation of the results displayed below.

If you want to know more about all parameter options, export formats, visualisation tools, please visit our main help page.

results table
Locus  : 1:234009-234092
Strand : -

GAAAUGAUGCGCAAAUGCGGAUAUCAAUGUAAAUCAGGGAGAAGGCAUGAUAUACCUUUAUAUCCGCAUUUGCGCAUCAUCUCU
((.(((((((((((((((((((((.((.(((.((((.(.......).)))).))).)).))))))))))))))))))))).)).
         <------miRBase------>                          <------miRBase------>
*********************............................................................... length=21 depth=5
.......*********************........................................................ length=21 depth=2
........................................................*********************....... length=21 depth=1
............................................................*********************... length=21 depth=16

hairpin with mature